BIOLOGICAL SAFETY AND BIOSECURITY
antioxidants are substances that inhibit oxidation and are able to neutralize the oxidative effect of free radicals. Dietary-derived antioxidants are now increasingly being researched for their positive health effects, including their role in the prevention of various diseases. In general, plant antioxidants receive a lot of attention as they can be consumed for longer periods of time without any side effects. Fruits are an important component of the human diet and play an important role in maintaining health. This is due to the presence of bioactive components that have a beneficial effect on human physiology. A number of plants have gained popularity as useful food items. Among them, persimmon (Diospyros kaki L.) can be distinguished, the fruits of which are nutritious and have strong antioxidant activity. This review summarizes data on the types of persimmon, its properties and methods of use.
the polymerase chain reaction (PCR) method is widely used to solve various problems. PCR is widely used for the detection of bacterial and viral pathogens. Primers are a very important component of PCR, since the specificity of amplification depends primarily on them. They are necessary for the enzyme to work and are specific to the fragment of interest. Based on the results of the selection of nucleotide sequences of the genome or individual fragments of the virus RNA from the international database on the NCBI website, a large number of sequences for the bovine leukemia virus were identified, which are stored in gene banks and updated daily with new data. The construction of primers in compliance with the necessary parameters is carried out using various computer programs, the main of which are MUSCLE, UGENE V.36.0, Primer-BLAST, Oligo Analyzer and others. The designed primers were then synthesized on the Expedite 8909 oligonucleotide synthesizer, according to the instructions attached to the device. As a result of our experiments, we selected and synthesized specific synthetic oligonucleotides env (g51)_1 and env (g51)_2, for setting up PCR for bovine leukemia.
this paper presents data on the study of the cultural properties of the genetic variant Omicron of the SARS-CoV-2 virus of the coronavirus infection COVID-19. The most permissive biological systems for the reproduction of this virus variant are Vero, MA-104, MARC-145, PK-15, and SPEV cell cultures. The productive conditions for cultivating the genetic variant Omicron of the SARS-CoV-2 virus in the studied cell lines turned out to be the following parameters: seeding concentration of cells 200 thousand/cm3, multiplicity of infection – 0.01 TCD50/cell, virus cultivation period – 2 days, cell lesion area monolayer before collecting the virus – 75-80%, the biological activity of the virus in the range from 4.14±0.31 to 6.66±0.22 lg TCD50/cm 3.
This article presents the results of statistical data as of July 1, compared with the same date last year, the number of horses as a whole increased by 8.5%, amounting to 3372.5 thousand heads as of July 1. However, during the winter months (January and February), the number of horses in Kazakhstan decreased by 1.3%. In absolute terms, the number of horses in January decreased by 20.2 thousand heads, and in February by another 16.6 thousand heads. In recent years, the country has seen an increase in the incidence of mytomy not only among foals, but also among adult livestock. In order to conduct epizootological monitoring of washing of horses, according to the calendar plan of the project IRN 08855635, from 2020-2022 scientific expeditions were organized on the territory of the Almaty region of the republic with the sampling of pathological material from sick animals. As a result of the purposeful organization and conduct of expedition trips, the necessary epidemiological data were collected and the analysis of ongoing veterinary and sanitary measures was carried out. As a result of this stage, samples were collected in a total of 112 samples of biomaterial from sick washed foals during sowing, it was possible to isolate the culture of the microbe only in 3 cases. This circumstance is due to the fact that the modified forms of mytaceous streptococcus causing atypical cases of the disease are very difficult to cultivate. According to the results of the study, bacterial isolates were identified as the species Streptococcus equi.
one of the main criteria for the biological safety of immunobiological preparations is their sterility. This article presents the results of the evaluation of two methods of direct seeding and membrane filtration. The results of sterility control of the inactivated vaccine against Covid-19 «QazCovid-in®, series № 0400721, № 0410721, № 0420721 are also presented. Evaluation of the sterility of the tested samples of the three vaccine series showed that after incubation, the nutrient medium remained clean both in direct seeding samples and membrane filtration samples, as well as accounting and evaluation of the obtained research data in accordance with the State Pharmacopoeia of the Republic of Kazakhstan. To assess the sensitivity of two methods for determining sterility, samples of immunobiological preparations were experimentally infected with cultures of test strains of St. aureus, C. albicans and C. sporogenes. As a result, the methods of membrane filtration and direct seeding showed the same sensitivity when detecting yeast and anaerobic organisms in all studied concentrations of test strains (10, 1, 0.1 CFU/ml). And for the detection of aerobic microorganisms, the membrane filtration method turned out to be more sensitive compared to the direct seeding method, which is proved by positive results in all samples of test strains with membrane filtration (3/3 in all concentrations) and negative results when setting the direct seeding method (in concentrations of 1 and 0.1 CFU/ml). Thus, the purpose of this study was to evaluate these two methods used to determine the sterility of immunobiological preparations using two methods: direct seeding and membrane filtration
the article presents the results of studies on approbation of a test system for the indication and identification of microscopic fungi Aspergillus flavus by the polymerase chain reaction method with real-time detection. Using software Multiple Sequence Alignment Viewer 1.22.1 and UGENA 44.0. The test system for A. flavus includes specific primers: forward primer (f) 5’-3’ GGGCCCGCAGCAAGAATAC, reverse primer (r) 3’-5’ ACGAGTTGTCACCTTCCCGAGA; fluorescent dye: HEX, probe - CGGTTCGCTTTGGTCATCGT, quencher BHQ2. Reaction protocol: preliminary denaturation - 95 0C - 5 minutes (1 cycle); denaturation - 95 0C - 5 sec, annealing - 60 0C - 15 sec (50 cycles). Probe: AGCATAGGCTGATGCTCGTAGGC, fluorescent dye - ROX, quencher - BHQ-2. The sensitivity of the test system is 1000 cells. The optimal concentration of primers was set equal to 9 pM of each primer per reaction. The optimal probe concentration is 0.4 pM. The results obtained indicate that the use of dichotomous keys does not allow the most accurate differentiation of phytopathogenic fungi A. flavus. A new approach to the identification of isolates confirmed the belonging of 15 isolated strains to the species A. flavus out of 20 isolated from corn samples with signs that manifest themselves as root rot and wilting, and initially typed as Aspergillus based on the study of cultural and morphological properties. The study was carried out according to the thematic plan-task of the Ministry of agriculture of the Russian Federation, the registration number of the INIS RTD 122030200367-8.
ISSN 2957-5702 (Online)