APPROVAL OF THE TEST-SYSTEM FOR THE INDICATION AND IDENTIFICATION OF ASPERGILLUS FLAVUS BY THE METHOD OF POLYMERASE CHAIN REACTION IN THE “REAL TIME” MODE

the article presents the results of studies on approbation of a test system for the indication and identification of microscopic fungi Aspergillus flavus by the polymerase chain reaction method with real-time detection. Using software Multiple Sequence Alignment Viewer 1.22.1 and UGENA 44.0. The test system for A. flavus includes specific primers: forward primer (f) 5’-3’ GGGCCCGCAGCAAGAATAC, reverse primer (r) 3’-5’ ACGAGTTGTCACCTTCCCGAGA; fluorescent dye: HEX, probe - CGGTTCGCTTTGGTCATCGT, quencher BHQ2. Reaction protocol: preliminary denaturation - 95 0C - 5 minutes (1 cycle); denaturation - 95 0C - 5 sec, annealing - 60 0C - 15 sec (50 cycles). Probe: AGCATAGGCTGATGCTCGTAGGC, fluorescent dye - ROX, quencher - BHQ-2. The sensitivity of the test system is 1000 cells. The optimal concentration of primers was set equal to 9 pM of each primer per reaction. The optimal probe concentration is 0.4 pM. The results obtained indicate that the use of dichotomous keys does not allow the most accurate differentiation of phytopathogenic fungi A. flavus. A new approach to the identification of isolates confirmed the belonging of 15 isolated strains to the species A. flavus out of 20 isolated from corn samples with signs that manifest themselves as root rot and wilting, and initially typed as Aspergillus based on the study of cultural and morphological properties. The study was carried out according to the thematic plan-task of the Ministry of agriculture of the Russian Federation, the registration number of the INIS RTD 122030200367-8.

1. Amaike S., Keller N. P. Aspergillus flavus // Annual review of phytopathology. – 2011. – Vol. 49. – No. 1. – P. 107-133.

2. Gourama H., Bullerman L. B. Aspergillus flavus and Aspergillus parasiticus: Aflatoxigenic fungi of concern in foods and feeds: A review // Journal of Food protection. – 1995. – Vol. 58. – No. 12. – P. 1395-1404.

3. Rudramurthy S. M. et al. Invasive aspergillosis by Aspergillus flavus: epidemiology, diagnosis, antifungal resistance, and management // Journal of Fungi. – 2019. – Vol. 5. – No. 3. – P. 55.

4. Cho H. J. et al. Regulation of Conidiogenesis in Aspergillus flavus // Cells. – 2022. – Vol. 11. – No. 18. – P. 2796.

5. Билай В.И., Коваль Э.З. Аспергиллы. – Киев: Наукова думка, 1988. – 204 с.

6. Билай В.И. Основы общей микологии. – Киев, Вища школа, 1980. – 360 с.

7. Рябинин И.А. Разработка ключа для видовой идентификации Aspergillus spp. – возбудителей заболеваний человека, циркулирующих в Северо-Западном округе России / И.А. Рябинин, С.С. Расулова // «Профилактическая медицина-2017»: сборник научных трудов Всероссийской научно-практической конференции с международным участием. 6–7 декабря 2017 года. Ч. 2. – СПб.: Изд-во СЗГМУ им. И.И. Мечникова, 2017. – 312 с.

8. Klich M.A. Identification of common Aspergillus species. – Utrech: Centraalbureeau voor Schimmelculture, 2002. – 116 p.

9. Стахеев А.А. Молекулярно-генетические методы в исследовании таксономии и специфической идентификации токсинпродуцирующих грибов рода Fusarium: успехи и проблемы / А.А. Стахеев, Л.В. Самохвалова, Д.Ю. Рязанцев, С.К. Завриев // Сельскохозяйственная биология. – 2016. – Т. 51. – №3. – С. 275-284.

10. Игнатьева С.М. Апробация мультиплексной тест-системы «HRM-Zygo-Asp» на клиническом материале больных мукормикозами / С.М. Игнатьева, В.А. Спиридонова, Т.С. Богомолова, Ю.Л. Авдеенко, Ю.В. Борзова, С.Н. Хостелиди, О.В. Шадривова, М.О. Попова, Ю.А. Чудиновских, И.С. Зюзгин, О.С. Успенская, Н.В. Васильева // Проблемы медицинской микологии. – 2019. – Т. 21. – №4. – С. 36-42.