Preview

Биобезопасность и Биотехнология

Расширенный поиск

Научный журнал «Биобезопасность и Биотехнология» принимает к публикации оригинальные исследовательские статьи, краткие сообщения и обзоры по следующим направлениям науки:

  • Биологическая безопасность и биологическая защита
  • Эпидемиология и эпизоотология, микробиология, вирусология, иммунология и микология. 
  • Ветеринарная биотехнология
  • Медицинская биотехнология
  • Фитопатология и биотехнология растений
  • Молекулярная генетика

Текущий выпуск

№ 12 (2022)
Скачать выпуск PDF

БИОЛОГИЧЕСКАЯ БЕЗОПАСНОСТЬ И БИОЗАЩИТА 

6-23 14
Аннотация

антиоксиданты – вещества, которые ингибируют окисление и способны нейтрализовать окислительное действие свободных радикалов. Антиоксиданты, полученные из рациона, в настоящее время все чаще исследуются на предмет их положительного воздействия на здоровье, включая их роль в профилактике различных заболеваний. В целом растительным антиоксидантам уделяется большое внимание, поскольку их можно употреблять в течение более длительных периодов времени без каких-либо побочных эффектов. Фрукты являются важным компонентом рациона человека и играют важную роль в поддержании здоровья. Это обусловлено наличием биоактивных компонентов, благотворно влияющих на физиологию человека. Ряд растений приобрел популярность как полезные пищевые объекты. Среди них можно выделить хурму (Diospyros kaki L.), плоды которой являются питательными и обладают сильной антиоксидантной активностью. В данном обзоре обобщены данные о видах хурмы, ее свойствах и способах использования.

24-35 2
Аннотация

метод полимеразной цепной реакции (ПЦР) широко применяется для решения различных задач. ПЦР широко применяется для детекции патогенов бактериальной и вирусной природы. Праймеры являются очень важным компонентом ПЦР, поскольку специфичность амплификации зависит в первую очередь от них. Они необходимы для работы фермента и являются специфичными к фрагменту интереса. По итогам отбора нуклеотидных последовательностей генома или отдельных фрагментов РНК вируса из международной базы данных на сайте NCBI, было выявлено большое количество последовательностей для вируса лейкоза крупного рогатого скота, которые хранятся в банках генов и ежедневно пополняющихся новыми данными. Конструирование праймеров с соблюдением необходимых параметров проводится с помощью различных компьютерных программ, основными из которых являются MUSCLE, UGENE V.36.0, Primer-BLAST, Oligo Analyzer и другие. Сконструированные праймеры затем синтезировали на синтезаторе олигонуклеотидов Expedite 8909, согласно инструкции прилагаемой к прибору. В результате проведенных опытов нами были подобраны и синтезированы специфические синтетические олигонуклеотиды env (g51) _1 и env (g51) _2, для постановки ПЦР при лейкозе крупного рогатого скота.

36-43 6
Аннотация

в настоящей работе представлены данные по изучению культуральных свойств генетического варианта Омикрон вируса SARS-CoV-2 коронавирусной инфекции COVID-19. Наиболее пермессивными биологическими системами для репродукции данного варианта вируса являются культуры клеток Vero, РК-15, СПЭВ, МА-104, MARC-145. Оптимальными условиями культивирования генетического варианта Омикрон вируса SARS-CoV-2 в изучаемых клеточных линиях оказались следующие параметры: посевная концентрация клеток 200 тыс/см3, множественность заражения – 0,01 ТЦД50/кл, срок культивирования вируса – 2 сут, площадь поражения клеточного монослоя перед сбором вируса – 75-80%, биологическая активность вируса в пределах от 4,14±0,31 до 6,66±0,22 lg ТЦД50/см3.

44-55 1
Аннотация

в данной статье представлены результаты статистические данные на 1 июля, по сравнению с аналогичной датой прошлого года поголовье лошадей в целом выросло на 8,5%, составив на 1 июля 3372,5 тыс. голов. Однако за зимние месяцы (январь и февраль) поголовье лошадей в Казахстане снизилось на 1,3%. В абсолютных цифрах поголовье лошадей в январе уменьшилось на 20,2 тыс. голов, а в феврале еще на 16,6 тыс. голов. За последние годы в стране наблюдается рост заболеваемости мытом не только среди жеребят, но и среди взрослого поголовья. С целью проведения эпизоотологического мониторинга мыта лощадей, согласно календарного плана проекта ИРН 08855635, с 2020-2022 годы были организованы научные экспедиционные выезды на территории Алматинской области республики с отбором проб патологического материала от больных животных. В результате целенаправленной организации и проведения экспедиционных выездов проведен сбор необходимых эпизоотологических данных и осуществлен анализ проводимых ветеринарно-санитарных мероприятий. В результате выполнения данного этапа был проведен сбор образцов в общем количестве 112 проб биоматериала от больных мытом жеребят при посеве удалось выделить культуру микроба только в 3 случаях. Данное обстоятельство связано с тем, что видоизмененные формы мытного стрептококка вызывающие атипичные случаи заболевания очень трудно поддаются культивированию. По результатам исследования бактериальные изоляты идентифицированы как вид Streptococcus equi.

56-66
Аннотация

одним из основных критериев биологической безопасности иммунобиологических препаратов является их стерильность. В данной статье представлены результаты оценки двух методов – прямого посева и мембранной фильтрации. А также представлены результаты контроля стерильности инактивированной вакцины против Covid-19 «QazCovid-in®», серии № 0400721, № 0410721, № 0420721. Оценка стерильности испытуемых образцов трех серий вакцины показала, что после инкубации питательная среда оставалась чистой как в образцах прямого посева, так и образцах мембранной фильтрации. Учет и оценка полученных данных исследований проведены в соответствии с Государственной Фармакопеей Республики Казахстан. Для оценки чувствительности двух методов определения стерильности, образцы иммунобиологических препаратов были экспериментально заражены культурами тест-штаммов Staphylococcus aureus, Candida albicans и Clostridium sporogenes. В результате определения стерильности на двух методах, мембранной фильтрации и прямого посева, образцы показали одинаковую чувствительность, при обнаружении дрожжей и анаэробных организмов во всех исследуемых концентрациях тест-штаммов (10, 1, 0,1 КОЕ/мл). А для обнаружения аэробных микроорганизмов метод мембранной фильтрации оказался более чувствительным по сравнению с методом прямого посева, доказательством являются положительные результаты во всех пробах тест-штаммов при мембранной фильтрации (3/3 во всех концентрациях) и отрицательные при постановке метода прямого посева (в концентрациях 1 и 0,1 КОЕ/мл). Таким образом, цель настоящего исследования заключалась в оценке этих двух методов, используемых для определения стерильности иммунобиологических препаратов.

67-73
Аннотация

в статье представлены результаты исследований по апробации тест-системы для индикации и идентификации микроскопических грибов Aspergillus flavus методом полимеразной цепной реакции с детекцией в режиме «реального времени». Применяя программное обеспечение Multiple Sequence Alignment Viewer 1.22.1 и UGENA 44.0. Тест-система для A. flavus включает специфические праймеры: прямой праймер (f) 5’-3’ GGGCCCGCAGCAAGAATAC, обратный праймер (r) 3’-5’ ACGAGTTGTCACCTTCCCGAGA; флуоресцентный краситель: HEX, зонд - CGGTTCGCTTTGGTCATCGT, гаситель BHQ2. Протокол постановки реакции: предварительная денатурация – 950C - 5 минут (1 цикл); денатурация - 950C - 5 сек, отжиг - 600C - 15 сек (50 циклов). Зонд: AGCATAGGCTGATGCTCGTAGGC, флуоресцентный краситель – ROX, гаситель - BHQ-2. Чувствительность тест-системы составляет 1000 клеток. Установлена оптимальная концентрация праймеров равная 9 pМ каждого праймера на реакцию. Оптимальная концентрация зонда - 0,4 pM. Полученные результаты свидетельствуют о том, что применение дихотомических ключей не позволяет максимально точно дифференцировать фитопатогенные грибы A. flavus. Новый подход к идентификации изолятов подтвердил принадлежность 15 выделенных штаммов к виду A. flavus из 20 выделенных из проб кукурузы с признаками, проявляющимися, как загнивание корней и увядание, и первично типированных как Aspergillus на основании изучения культурально-морфлогических свойств. Исследование выполнено согласно тематическому плану-заданию Министерства сельского хозяйства Российской Федерации, регистрационный номер ЕГИСУ НИОКТР 122030200367-8.



Creative Commons License
Контент доступен под лицензией Creative Commons Attribution 4.0 License.